Exercises

Exercise 11: Errors with colon, indent, etc.

Write the program ball_function.py as given in the text and confirm that the program runs correctly. Then save a copy of the program and use that program during the following error testing.

You are supposed to introduce errors in the code, one by one. For each error introduced, save and run the program, and comment how well Python's response corresponds to the actual error. When you are finished with one error, re-set the program to correct behavior (and check that it works!) before moving on to the next error.

a) Change the first line from def y(t): to def y(t), i.e., remove the colon.

Solution.

    def y(t)
            ^
SyntaxError: invalid syntax

b) Remove the indent in front of the statement v0 = 5 inside the function y, i.e., shift the text four spaces to the left.

Solution.

    v0 = 5
     ^
IndentationError: expected an indented block

c) Now let the statement v0 = 5 inside the function y have an indent of three spaces (while the remaining two lines of the function have four).

Solution.

    g = 9.81
    ^
IndentationError: unexpected indent

d) Remove the left parenthesis in the first statement def y(t):

Solution.

    def yt):
          ^
SyntaxError: invalid syntax

e) Change the first line of the function definition from def y(t): to def y():, i.e., remove the parameter t.

Solution.

    print y(time)

TypeError: y() takes no arguments (1 given)

f) Change the first occurrence of the statement print y(time) to print y().

Solution.

    print y()

TypeError: y() takes exactly 1 argument (0 given)

Filename: errors_colon_indent_etc.py.

Exercise 12: Compare integers a and b

Explain briefly, in your own words, what the following program does.

a = input('Give an integer a: ')
b = input('Give an integer b: ')

if a < b:
    print "a is the smallest of the two numbers"
elif a == b:
    print "a and b are equal"
else:
    print "a is the largest of the two numbers"

Proceed by writing the program, and then run it a few times with different values for a and b to confirm that it works as intended. In particular, choose combinations for a and b so that all three branches of the if construction get tested.

Solution.

Filename: compare_a_and_b.py.

Exercise 13: Functions for circumference and area of a circle

Write a program that takes a circle radius r as input from the user and then computes the circumference C and area A of the circle. Implement the computations of C and A as two separate functions that each takes r as input parameter. Print C and A to the screen along with an appropriate text. Run the program with \( r = 1 \) and confirm that you get the right answer.

Solution.

from math import *

def circumference(r):
    return 2*pi*r
def area(r):
    return pi*r**2

r = input('Give the radius of a circle: ')
C = circumference(r)
A = area(r)
print "Circumference: %g , Area: %g" % (C, A)

Give the radius of a circle: 1
Circumference: 6.28319 , Area: 3.14159

Filename: functions_circumference_area.py.

Exercise 14: Function for area of a rectangle

Write a program that computes the area \( A = b c \) of a rectangle. The values of \( b \) and \( c \) should be user input to the program. Also, write the area computation as a function that takes \( b \) and \( c \) as input parameters and returns the computed area. Let the program print the result to screen along with an appropriate text. Run the program with \( b = 2 \) and \( c = 3 \) to confirm correct program behavior.

Solution.

def area(s1, s2):
    return s1*s2

b = input('Give the one side of the rectangle: ')
c = input('Give the other side of the rectangle: ')
print "Area: ", area(b, c)

Give the one side of the rectangle: 2
Give the other side of the rectangle: 3
Area: 6

Filename: function_area_rectangle.py.

Exercise 15: Area of a polygon

One of the most important mathematical problems through all times has been to find the area of a polygon, especially because real estate areas often had the shape of polygons, and it was necessary to pay tax for the area. We have a polygon as depicted below.

The vertices ("corners") of the polygon have coordinates \( (x_1,y_1) \), \( (x_2,y_2) \), \( \ldots \), \( (x_n, y_n) \), numbered either in a clockwise or counter clockwise fashion. The area \( A \) of the polygon can amazingly be computed by just knowing the boundary coordinates: $$ A = \frac{1}{2}\left| (x_1y_2+x_2y_3 + \cdots + x_{n-1}y_n + x_ny_1) - (y_1x_2 + y_2x_3 + \cdots + y_{n-1}x_n + y_nx_1)\right|\thinspace .$$ Write a function polyarea(x, y) that takes two coordinate arrays with the vertices as arguments and returns the area. Assume that x and y are either lists or arrays.

Test the function on a triangle, a quadrilateral, and a pentagon where you can calculate the area by alternative methods for comparison.

Hint.

Solution.

"""
Computes the area of a polygon from vertex 
coordinates only.
"""

def polyarea(x, y):
    n = len(x)
    # next we may initialize area with those terms in the
    # sum that does not follow the "increasing index pattern"
    area = x[n-1]*y[0] - y[n-1]*x[0]  
    for i in range(0,n-1,1):
        area += x[i]*y[i+1] - y[i]*x[i+1]
    return 0.5*abs(area)

# pentagon
x = [0, 2, 2, 1, 0]
y = [0, 0, 2, 3, 2]
print 'Area pentagon (true value = 5): ', polyarea(x, y)
# quadrilateral
x = [0, 2, 2, 0]
y = [0, 0, 2, 2]
print 'Area quadrilateral (true value = 4): ', polyarea(x, y)
# triangle
x = [0, 2, 0]
y = [0, 0, 2]
print 'Area triangle (true value = 2): ', polyarea(x, y)

Filename: polyarea.py.

Exercise 16: Average of integers

Write a program that gets an integer \( N > 1 \) from the user and computes the average of all integers \( i = 1,\ldots,N \). The computation should be done in a function that takes \( N \) as input parameter. Print the result to the screen with an appropriate text. Run the program with \( N = 5 \) and confirm that you get the correct answer.

Solution.

def average(N):
    sum = 0
    for i in range(1, N+1):    # Note: Must use `N+1` to get `N`
        sum += i
    return sum/float(N)

N = input('Give an integer > 1: ')
average_1_to_N = average(N)
print "The average of 1,..., %d is: %g" % (N, average_1_to_N)

Give an integer > 1: 5
The average of 1,..., 5 is: 3

Filename: average_1_to_N.py.

Exercise 17: While loop with errors

Assume some program has been written for the task of adding all integers \( i = 1,2,\ldots,10 \):

some_number = 0
i = 1
while i < 11
    some_number += 1
print some_number

a) Identify the errors in the program by just reading the code and simulating the program by hand.

Solution.

b) Write a new version of the program with errors corrected. Run this program and confirm that it gives the correct output.

Solution.

some_number = 0;
i = 1
while i < 11:
    some_number += i
    i += 1
print some_number

Filename: while_loop_errors.py.

Exercise 18: Area of rectangle versus circle

Consider one circle and one rectangle. The circle has a radius \( r = 10.6 \). The rectangle has sides \( a \) and \( b \), but only \( a \) is known from the outset. Let \( a = 1.3 \) and write a program that uses a while loop to find the largest possible integer \( b \) that gives a rectangle area smaller than, but as close as possible to, the area of the circle. Run the program and confirm that it gives the right answer (which is \( b = 271 \)).

Solution.

from math import *

r = 10.6
a = 1.3    # one side of rectangle
circle_area = pi*r**2

b = 0      # chosen starting value for other side of rectangle
while a*b < circle_area:
    b += 1
b -= 1     # must reverse the last update to get the right value
print "The largest possible value of b: ", b

Filename: area_rectangle_vs_circle.py.

Exercise 19: Find crossing points of two graphs

Consider two functions \( f(x) = x \) and \( g(x) = x^2 \) on the interval \( [-4,4] \).

Write a program that, by trial and error, finds approximately for which values of \( x \) the two graphs cross, i.e., \( f(x) = g(x) \). Do this by considering \( N \) equally distributed points on the interval, at each point checking whether \( |f(x) - g(x)| < \epsilon \), where \( \epsilon \) is some small number. Let \( N \) and \( \epsilon \) be user input to the program and let the result be printed to screen. Run your program with \( N = 400 \) and \( \epsilon = 0.01 \). Explain the output from the program. Finally, try also other values of \( N \), keeping the value of \( \epsilon \) fixed. Explain your observations.

Solution.

from numpy import *

def f(x):
    return x

def g(x):
    return x**2

N = input('Give the number of check points N: ')
epsilon = input('Give the error tolerance: ')
x_values = linspace(-4, 4, N)

# Next, we run over all indices in the array `x_values` and
# check if the difference between function values is smaller than
# the chosen limit

for i in range(N):
    if abs(f(x_values[i]) - g(x_values[i])) < epsilon:
        print x_values[i]

Give the number of check-points N: 400

Give the error tolerance: 0.01
0.0100250626566
0.992481203008

Filename: crossing_2_graphs.py.

Exercise 20: Sort array with numbers

The import statement from random import * will give access to a function uniform that may be used to draw (pseudo-)random numbers from a uniform distribution between two numbers \( a \) (inclusive) and \( b \) (inclusive). For example, writing x = uniform(0,10) makes x a float value larger than, or equal to, \( 0 \), and smaller than, or equal to, \( 10 \).

Write a script that generates an array of \( 6 \) random numbers between \( 0 \) and \( 10 \). The program should then sort the array so that numbers appear in increasing order. Let the program make a formatted print of the array to the screen both before and after sorting. The printouts should appear on the screen so that comparison is made easy. Confirm that the array has been sorted correctly.

Solution.

from numpy import zeros
from random import uniform

N = 6
numbers = zeros(N)

# Draw random numbers
for i in range(len(numbers)):
    numbers[i] = uniform(0, 10)
print "Unsorted: %5.3f  %5.3f %5.3f %5.3f  %5.3f %5.3f" % \
        (numbers[0], numbers[1], numbers[2],\
         numbers[3], numbers[4], numbers[5])

for reference in range(N):
    smallest = numbers[reference]
    i_smallest = reference
    # Find the smallest number in remaining unprinted array
    for i in range(reference + 1, N, 1):
        if numbers[i] <= smallest:
            smallest = numbers[i]
            i_smallest = i
    # Switch numbers, and use an extra variable for that
    switch = numbers[reference]
    numbers[reference] = numbers[i_smallest]
    numbers[i_smallest] = switch

print "Sorted  : %5.3f  %5.3f %5.3f %5.3f  %5.3f %5.3f" % \
        (numbers[0], numbers[1], numbers[2],\
         numbers[3], numbers[4], numbers[5])

Filename: sort_numbers.py.

Exercise 21: Compute \( \pi \)

Up through history, great minds have developed different computational schemes for the number \( \pi \). We will here consider two such schemes, one by Leibniz (\( 1646-1716 \)), and one by Euler (\( 1707-1783 \)).

The scheme by Leibniz may be written $$ \begin{equation*} \pi = 8\sum_{k=0}^{\infty}\frac{1}{(4k + 1)(4k + 3)} , \nonumber \end{equation*} $$ while one form of the Euler scheme may appear as $$ \begin{equation*} \pi = \sqrt[]{6\sum_{k=1}^{\infty}\frac{1}{k^2}} . \nonumber \end{equation*} $$ If only the first \( N \) terms of each sum are used as an approximation to \( \pi \), each modified scheme will have computed \( \pi \) with some error.

Write a program that takes \( N \) as input from the user, and plots the error development with both schemes as the number of iterations approaches \( N \). Your program should also print out the final error achieved with both schemes, i.e. when the number of terms is N. Run the program with \( N = 100 \) and explain briefly what the graphs show.

Solution.

from numpy import pi, zeros, sqrt

no_of_terms = input('Give number of terms in sum for pi: ')
Leibniz_error = zeros(no_of_terms)
Euler_error = zeros(no_of_terms)

#Leibniz
sum1 = 0
for k in range(0, no_of_terms):
    sum1 += 1.0/((4*k + 1)*(4*k + 3))
    Leibniz_error[k] = pi - 8*sum1
sum1 *= 8
final_Leibniz_error = abs(pi - sum1)
print "Leibniz: ", final_Leibniz_error

# Euler
sum2 = 0
for k in range(1, no_of_terms+1):  # Note index range
    sum2 += 1.0/k**2
    Euler_error[k-1] = pi - sqrt(6*sum2)
sum2 *= 6
sum2 = sqrt(sum2)
final_Euler_error = abs(pi - sum2)
print "Euler: ", final_Euler_error

import matplotlib.pyplot as plt
plt.plot(range(no_of_terms), Leibniz_error, 'b-',\
         range(no_of_terms), Euler_error, 'r-')
plt.xlabel('No of terms')
plt.ylabel('Error with Leibniz (blue) and Euler (red)')
plt.show()

Give number of terms in sum for pi: 100
Leibniz: 0.00499996875098
Euler: 0.00951612178069

Filename: compute_pi.py.

Exercise 22: Compute combinations of sets

Consider an ID number consisting of two letters and three digits, e.g., RE198. How many different numbers can we have, and how can a program generate all these combinations?

If a collection of \( n \) things can have \( m_1 \) variations of the first thing, \( m_2 \) of the second and so on, the total number of variations of the collection equals \( m_1m_2\cdots m_n \). In particular, the ID number exemplified above can have \( 26\cdot 26\cdot 10\cdot 10\cdot 10 =676,000 \) variations. To generate all the combinations, we must have five nested for loops. The first two run over all letters A, B, and so on to Z, while the next three run over all digits \( 0,1,\ldots,9 \).

To convince yourself about this result, start out with an ID number on the form A3 where the first part can vary among A, B, and C, and the digit can be among 1, 2, or 3. We must start with A and combine it with 1, 2, and 3, then continue with B, combined with 1, 2, and 3, and finally combine C with 1, 2, and 3. A double for loop does the work.

a) In a deck of cards, each card is a combination of a rank and a suit. There are 13 ranks: ace (A), 2, 3, 4, 5, 6, 7, 8, 9, 10, jack (J), queen (Q), king (K), and four suits: clubs (C), diamonds (D), hearts (H), and spades (S). A typical card may be D3. Write statements that generate a deck of cards, i.e., all the combinations CA, C2, C3, and so on to SK.

Solution.

ranks = ['A', '2', '3', '4', '5', '6', '7',
         '8', '9', '10', 'J', 'Q', 'K']
suits = ['C', 'D', 'H', 'S']
deck = []
for s in suits:
    for r in ranks:
        deck.append(s + r)
print deck

b) A vehicle registration number is on the form DE562, where the letters vary from A to Z and the digits from 0 to 9. Write statements that compute all the possible registration numbers and stores them in a list.

Solution.

import string
letters = string.ascii_uppercase
digits = range(10)
registration_numbers = []
for place1 in letters:
    for place2 in letters:
        for place3 in digits:
            for place4 in digits:
                for place5 in digits:
                    registration_numbers.append(
                        '%s%s%s%s%s' %
                        (place1, place2, place3, place4, place5))
print registration_numbers

c) Generate all the combinations of throwing two dice (the number of eyes can vary from 1 to 6). Count how many combinations where the sum of the eyes equals 7.

Answer.

Solution.

dice = []
for d1 in range(1, 7):
    for d2 in range(1, 7):
        dice.append((d1, d2))

n = 0
for d1, d2 in dice:
    if d1 + d2 == 7:
        n += 1
print '%d combinations results in the sum 7' % n

Filename: combine_sets.py.

Exercise 23: Frequency of random numbers

Write a program that takes a positive integer \( N \) as input and then draws \( N \) random integers in the interval \( [1,6] \) (both ends inclusive). In the program, count how many of the numbers, \( M \), that equal 6 and write out the fraction \( M/N \). Also, print all the random numbers to the screen so that you can check for yourself that the counting is correct. Run the program with a small value for N (e.g., N = 10) to confirm that it works as intended.

Hint.

Solution.

from random import randint

N = input('How many random numbers should be drawn? ')

# Draw random numbers
M = 0   # Counter for the occurences of 6
for i in range(N):
    drawn_number = randint(1, 6)
    print 'Draw number %d gave: %d' % (i+1, drawn_number)
    if drawn_number == 6:
        M += 1

print 'The fraction M/N became: %g' % (M/float(N))

How many random numbers should be drawn? 10
Draw number 1 gave: 2
Draw number 2 gave: 4
Draw number 3 gave: 3
Draw number 4 gave: 2
Draw number 5 gave: 2
Draw number 6 gave: 1
Draw number 7 gave: 2
Draw number 8 gave: 6
Draw number 9 gave: 2
Draw number 10 gave: 3
The fraction M/N became: 0.1

Filename: count_random_numbers.py.

Remarks

For large \( N \), this program computes the probability \( M/N \) of getting six eyes when throwing a die.

Exercise 24: Game 21

Consider some game where each participant draws a series of random integers evenly distributed from \( 0 \) and \( 10 \), with the aim of getting the sum as close as possible to \( 21 \), but not larger than \( 21 \). You are out of the game if the sum passes \( 21 \). After each draw, you are told the number and your total sum, and is asked whether you want another draw or not. The one coming closest to \( 21 \) is the winner.

Implement this game in a program.

Hint.

Solution.

from random import randint

upper_limit = 21
not_finished = True
sum = 0
while not_finished:
    next_number = randint(0, 10)
    print "You got: ", next_number
    sum += next_number
    if sum > upper_limit:
        print "Game over, you passed 21 (with your %d points)!"\
                % sum
        not_finished = False
    else:
        print "Your score is now: %d points!" % (sum)
        answer = raw_input('Another draw (y/n)? ')
        if answer != 'y':
            not_finished = False
print "Finished!"

You got: 8
Your score is now: 8 points!

Another draw (y/n)? y
You got: 6
Your score is now: 14 points!

Another draw (y/n)? y
You got: 8
Game over, you passed 21 (with your 22 points)!

Filename: game_21.py.

Exercise 25: Linear interpolation

Some measurements \( y_i \), \( i = 1,2,\ldots,N \) (given below), of a quantity \( y \) have been collected regularly, once every minute, at times \( t_i=i \), \( i=0,1,\ldots,N \). We want to find the value \( y \) in between the measurements, e.g., at \( t=3.2 \) min. Computing such \( y \) values is called interpolation.

Let your program use linear interpolation to compute \( y \) between two consecutive measurements:

1. Find \( i \) such that \( t_i\leq t \leq t_{i+1} \).
2. Find a mathematical expression for the straight line that goes through the points \( (i,y_i) \) and \( (i+1,y_{i+1}) \).
3. Compute the \( y \) value by inserting the user's time value in the expression for the straight line.

Solution.

b) Write another function with in a loop where the user is asked for a time on the interval \( [0,N] \) and the corresponding (interpolated) \( y \) value is written to the screen. The loop is terminated when the user gives a negative time.

Solution.

c) Use the following measurements: \( 4.4, 2.0, 11.0, 21.5, 7.5 \), corresponding to times \( 0,1,\ldots,4 \) (min), and compute interpolated values at \( t=2.5 \) and \( t=3.1 \) min. Perform separate hand calculations to check that the output from the program is correct.

Solution.

from numpy import zeros

def interpolate(y, t):
    """Uses linear interpolation to find intermediate y"""
    i = int(t)
    # Scheme: y(t) = y_i + delta-y/delta-t * dt
    return y[i] + ((y[i+1] - y[i])/delta_t)*(t-i)

def find_y():
    """Repeatedly finds y at t by interpolation"""
    print 'For time t on the interval [0,%d]...' % (N)
    t = input('Give your desired t > 0: ')
    while t >= 0:
        print 'y(t) = %g' % (interpolate(y, t))
        t = input('Give new time t (to stop, enter t < 0): ')

# Note: do not need to store the sequence of times
N = 4            # Total number of measurements
delta_t = 1.0    # Time difference between measurements

y = zeros(5)
y[0] = 4.4; y[1] = 2.0; y[2] = 11.0;
y[3] = 21.5; y[4] = 7.5

find_y()

For time t on the interval [0,4]...
Give your desired t: 2.5
y(t) = 16.25

Give new time t: 0.5
y(t) = 3.2

Give new time t: -1

Filename: linear_interpolation.py.

Exercise 26: Test straight line requirement

Assume the straight line function \( f(x) = 4x + 1 \). Write a script that tests the "point-slope" form for this line as follows. Within a chosen interval on the \( x \)-axis (for example, for \( x \) between 0 and 10), randomly pick \( 100 \) points on the line and check if the following requirement is fulfilled for each point: $$ \frac{f(x_i) - f(c)}{x_i - c} = a,\hspace{.3in} i = 1,2,\ldots,100\thinspace , $$ where \( a \) is the slope of the line and \( c \) defines a fixed point \( (c,f(c)) \) on the line. Let \( c = 2 \) here.

Solution.

"""
For a straight line f(x) = ax + b, and the fixed point (2,f(2)) on 
the line, the script tests whether (f(x_i) - f(2)) / (x_i - 2) = a 
for randomly chosen x_i, i = 1,...,100.
"""

from random import random

def f(x):
    return a*x + b

a = 4.0; b = 1.0
c = 2; f_c = f(c)  # Fixed point on the line
epsilon = 1e-6
i = 0
for i in range(100):
    x = 10*random()   # random() returns number between 0 and 1
    numerator = f(x) - f_c
    denominator = x - c
    if denominator > epsilon:   # To avoid zero division
        fraction = numerator/denominator
        # The following printout should be very close to zero in
        # each case if the points are on the line
        print 'For x = %g : %g' % (x,abs(fraction - a))

For x = 2.67588 : 0
For x = 9.75893 : 0

Filename: test_straight_line.py.

Exercise 27: Fit straight line to data

Assume some measurements \( y_i, i = 1,2,\ldots,5 \) have been collected, once every second. Your task is to write a program that fits a straight line to those data.

Hint.

a) Make a function that computes the error between the straight line \( f(x)=ax+b \) and the measurements: $$ e = \sum_{i=1}^{5} \left(ax_i+b - y_i\right)^2\thinspace . $$

Solution.

b) Make a function with a loop where you give \( a \) and \( b \), the corresponding value of \( e \) is written to the screen, and a plot of the straight line \( f(x)=ax+b \) together with the discrete measurements is shown.

Hint.

Solution.

c) Given the measurements \( 0.5, 2.0, 1.0, 1.5, 7.5 \), at times \( 0, 1, 2, 3, 4 \), use the function in b) to interactively search for \( a \) and \( b \) such that \( e \) is minimized.

Solution.

from numpy import array
import matplotlib.pyplot as plt

def f(t,a,b):
    return a*t + b

def find_error(a, b):
    E = 0
    for i in range(len(time)):
        E += (f(time[i],a,b) - data[i])**2
    return E

def interactive_line_fit():
    one_more = True
    while one_more:
        a = input('Give a: ')
        b = input('Give b: ')
        print 'The error is: %g' % (find_error(a, b))
        y = f(time, a, b)
        plt.plot(time, y, time, data, '*') 
        plt.xlabel('Time (s)')
        plt.ylabel('y (stars) and straight line f(t)')
        plt.show()
        answer = raw_input('Do you want another fit (y/n)? ')
        if answer == "n":
            one_more = False

data = array([0.5, 2.0, 1.0, 1.5, 7.5])
time = array([0, 1, 2, 3, 4])

interactive_line_fit()

Give a: 1
Give b: 0
The error is: 16.75

Do you want another fit (y/n)? y
Give a: 0.5
Give b: 1
The error is: 22.75

Do you want another fit (y/n)? n

Filename: fit_straight_line.py.

Remarks

Fitting a straight line to measured data points is a very common task. The manual search procedure in c) can be automated by using a mathematical method called the method of least squares.

Exercise 28: Fit sines to straight line

A lot of technology, especially most types of digital audio devices for processing sound, is based on representing a signal of time as a sum of sine functions. Say the signal is some function \( f(t) \) on the interval \( [-\pi,\pi] \) (a more general interval \( [a,b] \) can easily be treated, but leads to slightly more complicated formulas). Instead of working with \( f(t) \) directly, we approximate \( f \) by the sum $$ \begin{equation} S_N(t) = \sum_{n=1}^{N} b_n \sin(nt), \tag{2.1} \end{equation} $$ where the coefficients \( b_n \) must be adjusted such that \( S_N(t) \) is a good approximation to \( f(t) \). We shall in this exercise adjust \( b_n \) by a trial-and-error process.

a) Make a function sinesum(t, b) that returns \( S_N(t) \), given the coefficients \( b_n \) in an array b and time coordinates in an array t. Note that if t is an array, the return value is also an array.

Solution.

b) Write a function test_sinesum() that calls sinesum(t, b) in a) and determines if the function computes a test case correctly. As test case, let t be an array with values \( -\pi/2 \) and \( \pi/4 \), choose \( N=2 \), and \( b_1=4 \) and \( b_2=-3 \). Compute \( S_N(t) \) by hand to get reference values.

Solution.

c) Make a function plot_compare(f, N, M) that plots the original function \( f(t) \) together with the sum of sines \( S_N(t) \), so that the quality of the approximation \( S_N(t) \) can be examined visually. The argument f is a Python function implementing \( f(t) \), N is the number of terms in the sum \( S_N(t) \), and M is the number of uniformly distributed \( t \) coordinates used to plot \( f \) and \( S_N \).

Solution.

d) Write a function error(b, f, M) that returns a mathematical measure of the error in \( S_N(t) \) as an approximation to \( f(t) \): $$ E = \sqrt{\sum_{i} \left(f(t_i) - S_N(t_i)\right)^2},$$ where the \( t_i \) values are \( M \) uniformly distributed coordinates on \( [-\pi, \pi] \). The array b holds the coefficients in \( S_N \) and f is a Python function implementing the mathematical function \( f(t) \).

Solution.

e) Make a function trial(f, N) for interactively giving \( b_n \) values and getting a plot on the screen where the resulting \( S_N(t) \) is plotted together with \( f(t) \). The error in the approximation should also be computed as indicated in d). The argument f is a Python function for \( f(t) \) and N is the number of terms \( N \) in the sum \( S_N(t) \). The trial function can run a loop where the user is asked for the \( b_n \) values in each pass of the loop and the corresponding plot is shown. You must find a way to terminate the loop when the experiments are over. Use M=500 in the calls to plot_compare and error.

Hint.

Solution.

f) Choose \( f(t) \) to be a straight line \( f(t) = \frac{1}{\pi}t \) on \( [-\pi,\pi] \). Call trial(f, 3) and try to find through experimentation some values \( b_1 \), \( b_2 \), and \( b_3 \) such that the sum of sines \( S_N(t) \) is a good approximation to the straight line.

Solution.

g) Now we shall try to automate the procedure in f). Write a function that has three nested loops over values of \( b_1 \), \( b_2 \), and \( b_3 \). Let each loop cover the interval \( [-1,1] \) in steps of \( 0.1 \). For each combination of \( b_1 \), \( b_2 \), and \( b_3 \), the error in the approximation \( S_N \) should be computed. Use this to find, and print, the smallest error and the corresponding values of \( b_1 \), \( b_2 \), and \( b_3 \). Let the program also plot \( f \) and the approximation \( S_N \) corresponding to the smallest error.

Solution.

from numpy import zeros, linspace, sin, sqrt, pi, copy, arange
import matplotlib.pyplot as plt

def sinesum(t, b):
    """
    Computes S as the sum over n of b_n * sin(n*t).
    For each point in time (M) we loop over all b_n to
    produce one element S[M], i.e. one element in
    S corresponds to one point in time.
    """
    S = zeros(len(t))
    for M in range(0, len(t), 1):
        for n in range(1, len(b)+1, 1):
            S[M] += b[n-1]*sin(n*t[M])
    return S

def test_sinesum():
    t = zeros(2); t[0] = -pi/2;  t[1] = pi/4
    b = zeros(2); b[0] = 4.0;  b[1] = -3
    print sinesum(t, b)

def plot_compare(f, N, M):
    time = linspace(left_end, right_end, M)
    y = f(time)
    S = sinesum(time, b)
    plt.plot(time, y, 'b-', time, S, 'r--')
    plt.xlabel('Time')
    plt.ylabel('f (blue) and S (red)')
    plt.show()

def error(b, f, M):
    time = linspace(left_end, right_end, M)
    y = f(time)
    S = sinesum(time, b)
    E = 0
    for i in range(len(time)):
        E += sqrt((y[i] - S[i])**2)
    return E

def trial(f, N):
    M = 500
    new_trial = True
    while new_trial:
        for i in range(N):
            text = 'Give b' + str(i+1) + ' : '
            b[i] = input(text)
        plot_compare(f, N, M)
        print 'The error is: ', error(b, f, M)
        answer = raw_input('Another trial (y/n)? ')
        if answer == 'n':
            new_trial = False

def f(t):
    return (1/pi)*t

def automatic_fit(f, N):
    """Search for b-values, - just pick limits and step"""
    global b
    M = 500
    # Produce and store an initially "smallest" error
    b[0] = -1; b[1] = -1; b[2] = -1
    test_b = copy(b)
    smallest_E = error(test_b, f, M)
    db = 0.1
    for b1 in arange(-1, 1+db, db):
        for b2 in arange(-1, 1+db, db):
            for b3 in arange(-1, 1+db, db):
                test_b[0] = b1; test_b[1] = b2;
                test_b[2] = b3
                E = error(test_b, f, M)
                if E < smallest_E:
                    b = copy(test_b)
                    smallest_E = E
    plot_compare(f, N, M)
    print 'The b coeffiecients: ', b
    print 'The smallest error found: ', smallest_E

left_end = -pi;  right_end = pi
N = 3
b = zeros(N)
#test_sinesum()
#trial(f, N)
automatic_fit(f, N)

The b coefficients: [ 0.6 -0.2 0.1 ]
The smallest error found: 67.1213886326

Filename: fit_sines.py.

Remarks

1. The function \( S_N(x) \) is a special case of what is called a Fourier series. At the beginning of the 19th century, Joseph Fourier (1768-1830) showed that any function can be approximated analytically by a sum of cosines and sines. The approximation improves as the number of terms (\( N \)) is increased. Fourier series are very important throughout science and engineering today.
   1. Finding the coefficients \( b_n \) is solved much more accurately in Exercise 41: Revisit fit of sines to a function, by a procedure that also requires much less human and computer work!
   2. In real applications, \( f(t) \) is not known as a continuous function, but function values of \( f(t) \) are provided. For example, in digital sound applications, music in a CD-quality WAV file is a signal with 44100 samples of the corresponding analog signal \( f(t) \) per second.

Exercise 29: Count occurrences of a string in a string

In the analysis of genes one encounters many problem settings involving searching for certain combinations of letters in a long string. For example, we may have a string like

gene = 'AGTCAATGGAATAGGCCAAGCGAATATTTGGGCTACCA'

We may traverse this string, letter by letter, by the for loop for letter in gene. The length of the string is given by len(gene), so an alternative traversal over an index i is for i in range(len(gene)). Letter number i is reached through gene[i], and a substring from index i up to, but not including j, is created by gene[i:j].

a) Write a function freq(letter, text) that returns the frequency of the letter letter in the string text, i.e., the number of occurrences of letter divided by the length of text. Call the function to determine the frequency of C and G in the gene string above. Compute the frequency by hand too.

b) Write a function pairs(letter, text) that counts how many times a pair of the letter letter (e.g., GG) occurs within the string text. Use the function to determine how many times the pair AA appears in the string gene above. Perform a manual counting too to check the answer.

c) Write a function mystruct(text) that counts the number of a certain structure in the string text. The structure is defined as G followed by A or T until a double GG. Perform a manual search for the structure too to control the computations by mystruct.

Solution.

gene = 'AGTCAATGGAATAGGCCAAGCGAATATTTGGGCTACCA'

def freq(letter, text):
    counter = 0
    for i in text:
        if i == letter:
            counter += 1
    return counter/float(len(text))

def pairs(letter, text):
    counter = 0
    for i in range(len(text)):
        if i < len(text)-1 and \
               text[i] == letter and text[i+1] == letter:
            counter += 1
    return counter

def mystruct(text):
    counter = 0
    for i in range(len(text)):
        # Search for the structure from position i
        if text[i] == 'G':
            print 'found G at', i
            # Search among A and T letters
            j = i + 1
            while text[j] == 'A' or text[j] == 'T':
                print 'next is ok:', text[j]
                j = j + 1
            print 'ending is', text[j:j+2]
            if text[j:j+2] == 'GG':
                # Correct ending of structure
                counter += 1
                print 'yes'
    return counter

print 'frequency of C: %.1f' % freq('C', gene)
print 'frequency of G: %.1f' % freq('G', gene)
print 'no of pairs AA: %d' % pairs('A', gene)
print 'no of structures: %d' % mystruct(gene)

Filename: count_substrings.py.

Remarks

You are supposed to solve the tasks using simple programming with loops and variables. While a) and b) are quite straightforward, c) quickly involves demanding logic. However, there are powerful tools available in Python that can solve the tasks efficiently in very compact code: a) text.count(letter)/float(len(text)); b) text.count(letter*2); c) len(re.findall('G[AT]+?GG', text)). That is, there is rich functionality for analysis of text in Python and this is particularly useful in analysis of gene sequences.

• ← Prev
• Next →