Basic constructions

_images/opt_exec.png

If tests

Very often in life, and in computer programs, the next action depends on the outcome of a question starting with “if”. This gives the possibility to branch into different types of action depending on some criterion. Let us as usual focus on a specific example, which is the core of so-called random walk algorithms used in a wide range of branches in science and engineering, including materials manufacturing and brain research. The action is to move randomly to the north (N), east (E), south (S), or west (W) with the same probability. How can we implement such an action in life and in a computer program?

We need to randomly draw one out of four numbers to select the direction in which to move. A deck of cards can be used in practice for this purpose. Let the four suits correspond to the four directions: clubs to N, diamonds to E, hearts to S, and spades to W, for instance. We draw a card, perform the corresponding move, and repeat the process a large number of times. The resulting path is a typical realization of the path of a diffusing molecule.

In a computer program, we need to draw a random number, and depending on the number, update the coordinates of the point to be moved. There are many ways to draw random numbers and translate them into (e.g.) four random directions, but the technical details usually depend on the programming language. Our technique here is universal: we draw a random number in the interval [0,1) and let [0,0.25) correspond to N, [0.25,0.5) to E, [0.5,0.75) to S, and [0.75,1) to W. Let x and y hold the coordinates of a point and let d be the length of the move. A pseudo code (i.e., not “real” code, just a “sketch of the logic”) then goes like

r = random number in [0,1)
if 0 <= r < 0.25
   move north: y = y + d
else if 0.25 <= r < 0.5
   move east:  x = x + d
else if 0.5 <= r < 0.75
   move south:  y = y - d
else if 0.75 <= r < 1
   move west:  x = x - d

Note the need for first asking about the value of r and then performing an action. If the answer to the “if” question is positive (true), we are done and can skip the next else if questions. If the answer is negative (false), we proceed with the next question. The last test if 0.75r<1 could also read just else, since we here cover all the remaining possible r values.

The exact code in Matlab reads

r = rand()          % random number in [0,1)
if 0 <= r < 0.25
   % move north
   y = y + d;
elseif 0.25 <= r < 0.5
   % move east
   x = x + d;
elseif 0.5 <= r < 0.75
   % move south
   y = y - d;
else
   % move west
   x = x - d;
end

We use else in the last test to cover the different types of syntax that is allowed. Matlab recognizes the reserved words if, elseif, and else and expects the code to be compatible with the rules of if tests:

  • The test reads if condition, elseif condition, or else, where condition is a boolean expression that evaluates to true (1) or false (0).
  • If condition is true, the following statements up to the next elseif, else, or end are executed, and the remaining if, elseif, or else branches are skipped.
  • If condition is false, the program flow jumps to the next if, elseif, or else branch.

The blocks after if, elseif, or else may contain new if tests, if desired.

Working with if tests requires mastering boolean expressions. Here are some basic boolean expressions involving the logical operators ==, ~=, <, <=, >, and >=. Given the assignment to temp, you should go through each boolean expression below and determine if it is true or false.

temp = 21       % assign value to a variable
temp == 20      % temp equal to 20
temp ~= 20      % temp not equal to 20
temp <  20      % temp less than 20
temp >  20      % temp greater than 20
temp <= 20      % temp less than or equal to 20
temp >= 20      % temp greater than or equal to 20

Functions

Functions are widely used in programming and is a concept that needs to be mastered. In the simplest case, a function in a program is much like a mathematical function: some input number x is transformed to some output number. One example is the tanh1(x) function, called atan in computer code: it takes one real number as input and returns another number. Functions in Matlab are more general and can take a series of variables as input and return one or more variables, or simply nothing. The purpose of functions is two-fold:

  1. to group statements into separate units of code lines that naturally belong together (a strategy which may dramatically ease the problem solving process), and/or
  2. to parameterize a set of statements such that they can be written only once and easily be re-executed with variations.

Examples will be given to illustrate how functions can be written in various contexts.

If we modify the program ball.m from the chapter A Matlab program with variables slightly, and include a function, we could let this be a new program ball_function.m as

function ball_function()
    % This is the main program
    time = 0.6;                     % Just pick some time
    vertical_position = y(time);
    fprintf('%f \n',vertical_position)
    time = 0.9;                     % Pick another time
    vertical_position = y(time);
    fprintf('%f \n',vertical_position)
end

% The function 'y' is a _local_ function in this file
function result = y(t)
    g = 9.81;      % Acceleration of gravity
    v0 = 5;        % Initial velocity
    result = v0*t - 0.5*g*t^2;
end

Here, Matlab interprets this as the definition of two functions, recognized by the reserved word function that appears two places. The first function ball_function, is defined by the statements between (and including) function ball_function() and the first end. Note that the first function in a file should have the same name as the name of the file (apart from the extension .m). The second function, i.e. y, is similarly defined between function result = y(t) and the second end.

Opposed to the function y, the function ball_function does not return a value. This is stated in the first line of each function definition. Comparing, you notice that y has an assignment there, whereas ball_function has not. The final statement of the function y, i.e.

result = v0*t - 0.5*g*t^2;

will be understood by Matlab as “first compute the expression, then place the result in result and send it back (i.e. return) to where the function was called from”. The function depends on one variable (or we say that it takes one argument or input parameter), the value of which must be provided when the function is called.

What do these things mean? Well, the function definition itself, e.g. of y, just tells Matlab that there is a function y, taking the specified arguments as input, and returning a specified output result. Matlab keeps this information ready for use in case a call to y is performed elsewhere in the code. In our case, a call to y happens twice by the line vertical_position = y(time). By this instruction, Matlab takes y(time) as a call to the function y, assigning the value of time to the variable t. So in the first call, t becomes 0.6, while in the second call t becomes 0.9. In both cases the code lines of y are executed and the returned result (the output parameter) is stored in vertical_position, before it is next printed by Matlab.

Note that the reserved word return may be used to enforce a return from a function before it reaches the end. For example, if a function contains if-elseif-else constructions, return may be done from within any of the branches. This may be illustrated by the following function containing three return statements:

function result = check_sign(x)
    if x > 0
        result = 'x is positive';
        return;
    elseif x < 0
        result = 'x is negative';
        return;
    else
        result = 'x is zero';
        return;
    end
end

Remember that only one of the branches is executed for a single call on check_sign, so depending on the number x, the return may take place from any of the three return alternatives.

One phrase you will meet often when dealing with programming, is main program or main function, or that some code is in main. This is nothing particular to Matlab, and simply means the first function that is defined in a file, e.g. ball_function above. You may define as many functions as you like in a file after the main function. These then become local functions, i.e. they are only known inside that file. In particular, only the main function may be called from the command window, whereas local functions may not.

A function may take no arguments, or many, in which case they are just listed within the parentheses (following the function name) and separated by a comma. Let us illustrate. Take a slight variation of the ball example and assume that the ball is not thrown straight up, but at an angle, so that two coordinates are needed to specify its position at any time. According to Newton’s laws (when air resistance is negligible), the vertical position is given by y(t)=v0yt0.5gt2 and the horizontal position by x(t)=v0xt. We can include both these expressions in a new version of our program that prints the position of the ball for chosen times. Assume we want to evaluate these expressions at two points in time, t=0.6s and t=0.9s. We can pick some numbers for the initial velocity components v0y and v0x, name the program ball_position.m, and write it for example as

function ball_position_xy()
    initial_velocity_x = 2.0;
    initial_velocity_y = 5.0;

    time = 0.6;  % Just pick one point in time
    x_pos = x(initial_velocity_x, time);
    y_pos = y(initial_velocity_y, time);
    fprintf('%f %f \n', x_pos, y_pos)

    time = 0.9;  % Pick another point in time
    x_pos = x(initial_velocity_x, time);
    y_pos = y(initial_velocity_y, time);
    fprintf('%f %f \n', x_pos, y_pos)
end

function result = y(v0y, t)
    g = 9.81;      % Acceleration of gravity
    result = v0y*t - 0.5*g*t^2;
end

function result = x(v0x, t)
    result = v0x*t;
end

Now we compute and print the two components for the position, for each of the two chosen points in time. Notice how each of the two functions now takes two arguments. Running the program gives the output

1.2  1.2342
1.8  0.52695

A function may also return more than one value. For example, the two functions we just defined could alternatively have been defined into one as

function [result1, result2] = xy(v0x, v0y, t)
    g = 9.81;        % acceleration of gravity
    result1 = v0x*t;
    result2 = v0y*t - 0.5*g*t^2;
end

Notice the two return values result1 and result2 that are listed in the function header, i.e., the first line of the function definition. When calling the function, arguments must appear in the same order as in the function definition. We would then write

[x_pos,y_pos] = xy(initial_x_velocity, initial_y_velocity, time);

The variables x_pos and y_pos could then have been printed or used in other ways in the code.

There are possibilities for having a variable number of function input and output parameters (using nargin and nargout). However, we do not go further into that topic here.

Variables that are defined inside a function, e.g., g in the last xy function, are local variables. This means they are only known inside the function. Therefore, if you had accidentally used g in some calculation outside the function, you would have got an error message. By use of the reserved word global, a variable may be known also outside the function in which it is defined (without transferring it as a parameter). For example, if, in some function A, we write

global some_variable;
some_variable = 2;

then, in another function B, we could use some_variable directly if we just specify it first as being global, e.g.

global some_variable;
some_other_variable = some_variable*2;

We could even change the value of some_variable itself inside B if we like, so that upon return to the function A, some_variable would have a new value. If you define one global and one local variable, both with the same name, the function only sees the local one, so the global variable is not affected by what happens with its local companion of the same name. The arguments named in the header of a function definition are by rule local variables inside the function. One should strive to define variables mostly where they are needed and not everywhere.

In any programming language, it is a good habit to include a little explanation of what the function is doing, unless what is done by the function is obvious, e.g., when having only a few simple code lines. This explanation (sometimes known as a doc string) should be placed just at the top of the function. This explanation is meant for a human who wants to understand the code, so it should say something about the purpose of the code and possibly explain the arguments and return values if needed. If we do that with our xy function from above, we may write the first lines of the function as

function xy(v0x, v0y, t)
    % Compute the x and y position of the ball at time t

Note that a function you have written may call another function you have written, even if they are not defined within the same file. Such a call requires the called function to be located in a file with the same name as the function (apart from the extension .m). This file must also be located in a folder where Matlab can find it, e.g. in the same folder as the calling function.

Functions are straightforwardly passed as arguments to other functions, as illustrated by the following script function_as_argument.m:

function function_as_argument()
    x = 2;
    y = 3;

    % Create handles to the functions defined below
    sum_xy_handle = @sum_xy;
    prod_xy_handle = @prod_xy;

    sum = treat_xy(sum_xy_handle, x, y);
    fprintf('%f \n', sum);
    prod = treat_xy(prod_xy_handle, x, y);
    fprintf('%f \n', prod);
end

function result = treat_xy(f, x, y)
    result = f(x, y);
end

function result = sum_xy(x, y)
    result = x + y;
end

function result = prod_xy(x, y)
    result = x*y;
end

When run, this program first prints the sum of x and y (i.e., 5), and then it prints the product (i.e., 6). We see that treat_xy takes a function name as its first parameter. Inside treat_xy, that function is used to actually call the function that was given as input parameter. Therefore, as shown, we may call treat_xy with either sum_xy or prod_xy, depending on whether we want the sum or product of x and y to be calculated.

To transfer a function to the function treat_xy, we must use function handles, one for each function we want to transfer. This is done by the sign @ combined with the function name, as illustrated by the lines

sum_xy_handle = @sum_xy;
prod_xy_handle = @prod_xy;

Note that it is the handle that is used in the function call, as, e.g., in

sum = treat_xy(sum_xy_handle,x,y);

Functions may also be defined within other functions. It that case, they become local functions, or nested functions, known only to the function inside which they are defined. Functions defined in main are referred to as global functions. A nested function has full access to all variables in the parent function, i.e. the function within which it is defined.

One convenient way of defining one-line functions (they can not be more than one line!), is by use of anonymous functions. You may then define, e.g., a square function by the name my_square, as

my_square = @(x) x^2;

and then use it simply as

y = my_sqare(2);

which would have assigned the value 4 to y. Note that my_square here becomes a handle that may be used directly as a function parameter for example.

Overhead of function calls

Function calls have the downside of slowing down program execution. Usually, it is a good thing to split a program into functions, but in very computing intensive parts, e.g., inside long loops, one must balance the convenience of calling a function and the computational efficiency of avoiding function calls. It is a good rule to develop a program using plenty of functions and then in a later optimization stage, when everything computes correctly, remove function calls that are quantified to slow down the code.

For loops

Many computations are repetitive by nature and programming languages have certain loop structures to deal with this. Here we will present what is referred to as a for loop (another kind of loop is a while loop, to be presented afterwards). Assume you want to calculate the square of each integer from 3 to 7. This could be done with the following two-line program.

for i = 3:7
    i^2
end

What happens when Matlab interprets your code here? First of all, the word for is a reserved word signalling to Matlab that a for loop is wanted. Matlab then sticks to the rules covering such constructions and understands that, in the present example, the loop should run 5 successive times (i.e., 5 iterations should be done), letting the variable i take on the numbers 3,4,5,6,7 in turn. During each iteration, the statement inside the loop (i.e. i^2) is carried out. After each iteration, i is automatically (behind the scene) updated. When the last number is reached, the last iteration is performed and the loop is finished. When executed, the program will therefore print out 9,16,25,36 and 49. The variable i is often referred to as a loop index, and its name (here i) is a choice of the programmer.

Note that, had there been several statements within the loop, they would all be executed with the same value of i (before i changed in the next iteration). Make sure you understand how program execution flows here, it is important.

The specification of the values desired for the loop variable (here 3:7) is more generally given as start:step:stop, meaning that the loop variable should take on the integers from start to stop, inclusive at both ends, in steps of step. If step is skipped, the default value is 1, as in the example above. Note that decreasing integers may be produced by letting start > stop combined with a negative step. This makes it easy to, e.g., traverse arrays in either direction.

Let us modify ball_plot.m from the chapter A Matlab program with vectorization and plotting to illustrate how useful for loops are if you need to traverse arrays. In that example we computed the height of the ball at every milli-second during the first second of its (vertical) flight and plotted the height versus time.

Assume we want to find the maximum height during that time, how can we do it with a computer program? One alternative may be to compute all the thousand heights, store them in an array, and then run through the array to pick out the maximum. The program, named ball_max_height.m, may look as follows.

g = 9.81;
v0 = 5;
t = linspace(0, 1, 1000);
y = v0*t - 0.5*g*t.^2;

% At this point, the array y with all the heights is ready.
% Now we need to find the largest value within y.

largest_height = y(1);   % Preliminary value
for i = 2:1000
   if y(i) > largest_height
       largest_height = y(i);
   end
end

fprintf('The largest height achieved was %f m \n',largest_height);

% We might also like to plot the path again just to compare
plot(t,y);
xlabel('Time (s)');
ylabel('Height (m)')

There is nothing new here, except the for loop construction, so let us look at it in more detail. As explained above, Matlab understands that a for loop is desired when it sees the word for. The value in y(1) is used as the preliminary largest height, so that, e.g., the very first check that is made is testing whether y(2) is larger than this height. If so, y(2) is stored as the largest height. The for loop then updates i to 2, and continues to check y(3), and so on. Each time we find a larger number, we store it. When finished, largest_height will contain the largest number from the array y. When you run the program, you get

The largest height achieved was 1.274210 m

which compares favorably to the plot that pops up.

To implement the traversing of arrays with loops and indices, is sometimes challenging to get right. You need to understand the start, stop and step length choices for an index, and also how the index should enter expressions inside the loop. At the same time, however, it is something that programmers do often, so it is important to develop the right skills on these matters.

Having one loop inside another, referred to as a double loop, is sometimes useful, e.g., when doing linear algebra. Say we want to find the maximum among the numbers stored in a 4×4 matrix A. The code fragment could look like

largest_number = A(1,1);

for i = 1:length(A)
    for j = 1:length(A)
        if A(i,j) > largest_number
            largest_number = A(i,j);
        end
    end
end

Here, all the j indices (1 - 4) will be covered for each value of index i. First, i stays fixed at i = 1, while j runs over all its indices. Then, i stays fixed at i = 2 while j runs over all its indices again, and so on. Sketch A on a piece of paper and follow the first few loop iterations by hand, then you will realize how the double loop construction works. Using two loops is just a special case of using multiple or nested loops, and utilizing more than two loops is just a straightforward extension of what was shown here. Note, however, that the loop index name in multiple loops must be unique to each of the nested loops. Note also that each nested loop may have as many code lines as desired, both before and after the next inner loop.

The vectorized computation of heights that we did in ball_plot.m (the chapter A Matlab program with vectorization and plotting) could alternatively have been done by traversing the time array (t) and, for each t element, computing the height according to the formula y=v0t12gt2. However, it is important to know that vectorization goes much quicker. So when speed is important, vectorization is valuable.

Use loops to compute sums

One important use of loops, is to calculate sums. As a simple example, assume some variable x given by the mathematical expression

x=Ni=12i,

i.e., summing up the N first even numbers. For some given N, say N=5, x would typically be computed in a computer program as:

N = 5;
x = 0;
for i = 1:N
    x = x + 2*i;
end
x

Executing this code will print the number 30 to the screen. Note in particular how the accumulation variable x is initialized to zero. The value of x then gets updated with each iteration of the loop, and not until the loop is finished will x have the correct value. This way of building up the value is very common in programming, so make sure you understand it by simulating the code segment above by hand. It is a technique used with loops in any programming language.

While loops

Matlab also has another standard loop construction, the while loop, doing iterations with a loop index very much like the for loop. To illustrate what such a loop may look like, we consider another modification of ball_plot.m in the chapter A Matlab program with vectorization and plotting. We will now change it so that it finds the time of flight for the ball. Assume the ball is thrown with a slightly lower initial velocity, say 4.5 ms1, while everything else is kept unchanged. Since we still look at the first second of the flight, the heights at the end of the flight become negative. However, this only means that the ball has fallen below its initial starting position, i.e., the height where it left the hand, so there is no problem with that. In our array y we will then have a series of heights which towards the end of y become negative. Let us, in a program named ball_time.m find the time when heights start to get negative, i.e., when the ball crosses y=0. The program could look like this

g = 9.81;
v0 = 4.5;                  % Initial velocity
t = linspace(0, 1, 1000);  % Acceleration of gravity
y = v0*t - 0.5*g*t.^2;     % Generate all heights

% At this point, the array y with all heights is ready

i = 1;
while y(i) >= 0
   i = i + 1;
end

% Having the index, we may look up the time in the array t
fprintf('The time (switch from positive to negative): %f\n', t(i));

% We plot the path again just for comparison
plot(t, y);
xlabel('Time (s)');
ylabel('Height (m)');

If you type and run this program you should get

y=0 at 0.917417417417

The new thing here is the while loop only. The loop will run as long as the boolean expression y(i) >= 0 evaluates to true. Note that the programmer introduced a variable (the loop index) by the name i, initialized it (i = 1) before the loop, and updated it (i = i + 1) in the loop. So for each iteration, i is explicitly increased by 1, allowing a check of successive elements in the array y.

Compared to a for loop, the programmer does not have to specify the number of iterations when coding a while loop. It simply runs until the boolean expression becomes false. Thus, a loop index (as we have in a for loop) is not required. Furthermore, if a loop index is used in a while loop, it is not increased automatically; it must be done explicitly by the programmer. Of course, just as in for loops and if blocks, there might be (arbitrarily) many code lines in a while loop. Any for loop may also be implemented as a while loop, but while loops are more general so not all of them can be expressed as a for loop.

A problem to be aware of, is what is usually referred to as an infinite loop. In those unintentional (erroneous) cases, the boolean expression of the while test never evaluates to false, and the program can not escape the loop. This is one of the most frequent errors you will experience as a beginning programmer. If you accidentally enter an infinite loop and the program just hangs forever, press Ctrl+c to stop the program.

Reading from and writing to files

Input data for a program often come from files and the results of the computations are often written to file. To illustrate basic file handling, we consider an example where we read x and y coordinates from two columns in a file, apply a function f to the y coordinates, and write the results to a new two-column data file. The first line of the input file is a heading that we can just skip:

% x and y coordinates
1.0  3.44
2.0  4.8
3.5  6.61
4.0  5.0

The relevant Matlab lines for reading the numbers and writing out a similar file are given in the file file_handling.m

filename = 'tmp.dat';
infileID = fopen(filename, 'r');   % Open file for reading
fgetl(infileID);                   % Read and skip first line

% First read file to count number of lines with data
no_of_lines = 0;
while ~feof(infileID)
    no_of_lines = no_of_lines + 1;
    fgetl(infileID);
end
fclose(infileID);

% Can now define arrays x and y of known length
x = zeros(no_of_lines, 1);
y = zeros(no_of_lines, 1);

% Re-open the file for reading
infileID = fopen(filename, 'r');   % Open file for reading
fgetl(infileID);                   % Read and skip first line

% Read x and y coordinates from the file and store in arrays
i = 1;
while i <= no_of_lines
    x(i) = fscanf(infileID, '%f', 1);
    y(i) = fscanf(infileID, '%f', 1);
    i = i + 1;
end
fclose(infileID);

% Next, we treat the y-coordinates and write to file

F = @(y) log(y);
y = F(y);    % Overwrite y with new values

filename = 'tmp_out.dat';
outfileID = fopen(filename, 'w');   % Open file for writing
i = 1;
while i <= no_of_lines
    fprintf(outfileID, '%10.5f %10.5f', x(i), y(i));
    i = i + 1;
end
fclose(outfileID);

Such a file with a comment line and numbers in tabular format is very common so Matlab has functionality to ease reading and writing. Here is the same example (file file_handling_easy.m):

filename = 'tmp.dat';
data = load(filename);
x = data(:,1);
y = data(:,2);
data(:,2) = log(y); % insert transformed y back in array
filename = 'tmp_out.dat';
outfile = fopen(filename, 'w'); % open file for writing
fprintf(outfile, '%% x and y coordinates\n');
fprintf(outfile, '%10.5f %10.5f\n', data);
fclose(outfile);

Exercises

Exercise 10: Introducing errors

Write the program ball_function.m as given in the text and confirm that the program runs correctly. Then save a copy of the program and use that program during the following error testing.

You are supposed to introduce errors in the code, one by one. For each error introduced, save and run the program, and comment how well Matlab’s response corresponds to the actual error. When you are finished with one error, re-set the program to correct behavior (and check that it works!) before moving on to the next error.

a) Change the first line from function ball_function() to ball_function(), i.e. remove the word function.

Solution. Running the program gives an error message containing

Error: Unexpected input at line number: 9

as well as the name of the file in which this problem occurred. The last part of the error message reads:

    fprintf('%f \n',vertical_position);
end
  ^

Matlab reacts to the word end here. However, (as we know) end is correctly used and placed, the problem is rather that the word function to which end was supposed to match, is not there! So, Matlab responds by stating that it does not understand the word end. With such error messages, the programmer has to understand whether end is to be removed, or if some other keyword (here function) lacks in the above.

b) Change the first line from function ball_function() to function ball_func(), i.e., change the name of the function.

Solution. The program runs as before, i.e. no error messages. This is because Matlab understands that the (main or first) function in the file ball_function.m is supposed to be run, even if the name of that function is not the same as the name of the file in which the function definition is located.

c) Change the line function result = y(t) to function y(t).

Solution. Running the program gives an error message containing the line in which Matlab found a problem (line 4 here), as well as a message telling us what seems to be wrong

Error: Too many outputs to function y

Again, there is a mismatch between the function y(t) as it now (wrongly) is defined and the way it is used. In the erroneous definition, we have not specified in the header of the function that there is to be a return value from the function. Therefore, when we state in line 4 that we want the return value from the function to be stored in vertical_position, Matlab gets a problem.

d) Change the line function result = y(t) to function result = y(), i.e., remove the parameter t.

Solution. Running the program gives an error message containing the line in which Matlab found a problem (line 4 here), as well as a message telling us what seems to be wrong

Error: Too many inputs to function y

Again, there is a mismatch between the function y as it now (wrongly) is defined and the way it is used. In the erroneous definition, we have not specified that the function should have an input parameter. Therefore, when we (in line 4) call the function with a parameter, Matlab gets a problem.

e) Change the first statement that calls y from vertical_position = y(time); to vertical_position = y();.

Solution. Running the program gives an error message containing the line in which Matlab found a problem (line 4 here), as well as a message telling us what seems to be wrong

Error: Undefined function or variable t

This message tells us that the input parameter t does not get any value assigned. We have defined the function to take one parameter, but we call it without any parameter.

Filename: introducing_errors.m.

Exercise 11: Compare integers a and b

Explain briefly, in your own words, what the following program does.

a = input('Give an integer a: ');
b = input('Give an integer b: ');

if a < b
    fprintf('a is the smallest of the two numbers\n');
elseif a == b
    fprintf('a and b are equal\n');
else
    fprintf('a is the largest of the two numbers\n');
end

Proceed by writing the program, and then run it a few times with different values for a and b to confirm that it works as intended. In particular, choose combinations for a and b so that all three branches of the if construction get tested.

Solution. The program takes two integers as input and checks if the number a is smaller than b, equal to b, or larger than b. A message is printed to the screen in each case.

Filename: compare_a_and_b.m.

Exercise 12: Functions for circumference and area of a circle

Write a program that takes a circle radius r as input from the user and then computes the circumference C and area A of the circle. Implement the computations of C and A as two separate functions that each takes r as input parameter. Print C and A to the screen along with an appropriate text. Run the program with r=1 and confirm that you get the right answer.

Solution. The code reads:

circumference = @(r) 2*pi*r;
area = @(r) pi*r^2;

r = input('Give the radius of a circle: ');
C = circumference(r);
A = area(r);
fprintf('Circumference: %g , Area: %g\n', C, A);

Running the program, choosing r = 1, gives the following dialog:

Give the radius of a circle: 1
Circumference: 6.28319 , Area: 3.14159

Filename: functions_circumference_area.m.

Exercise 13: Function for area of a rectangle

Write a program that computes the area A=bc of a rectangle. The values of b and c should be user input to the program. Also, write the area computation as a function that takes b and c as input parameters and returns the computed area. Let the program print the result to screen along with an appropriate text. Run the program with b=2 and c=3 to confirm correct program behavior.

Solution. The code reads:

area = @(s1, s2) s1*s2;

b = input('Give the one side of the rectangle: ');
c = input('Give the other side of the rectangle: ');
A = area(b, c);
fprintf('Area: %g\n',A);

Running the program gives the following dialog:

Give the one side of the rectangle: 2
Give the other side of the rectangle: 3
Area:

ans = 6

Filename: function_area_rectangle.m.

Exercise 14: Area of a polygon

One of the most important mathematical problems through all times has been to find the area of a polygon, especially because real estate areas often had the shape of polygons, and it was necessary to pay tax for the area. We have a polygon as depicted below.

_images/polygon.png

The vertices (“corners”) of the polygon have coordinates (x1,y1), (x2,y2), , (xn,yn), numbered either in a clockwise or counter clockwise fashion. The area A of the polygon can amazingly be computed by just knowing the boundary coordinates:

A=12|(x1y2+x2y3++xn1yn+xny1)(y1x2+y2x3++yn1xn+ynx1)|.

Write a function polyarea(x, y) that takes two coordinate arrays with the vertices as arguments and returns the area. Assume that x and y are either lists or arrays.

Test the function on a triangle, a quadrilateral, and a pentagon where you can calculate the area by alternative methods for comparison.

Solution. Code:

% Computes the area of a polygon from vertex
% coordinates only.

function area = polyarea(x, y)
    n = length(x);
    % next we may initialize area with those terms in the
    % sum that does not follow the "increasing index pattern"
    area = x(n)*y(1) - y(n)*x(1);
    for i = 1:(n-1)
        area = area + x(i)*y(i+1) - y(i)*x(i+1);
    end
    area = 0.5*abs(area);
end

The simple tests may be executed by running another function (test_polyarea.m) that calls the former:

% pentagon
x = [0 2 2 1 0];
y = [0 0 2 3 2];
fprintf('Area pentagon (true value = 5): %g\n', polyarea(x, y));

% quadrilateral
x = [0 2 2 0];
y = [0 0 2 2];
fprintf('Area quadrilateral (true value = 4): %g\n', polyarea(x, y));

% triangle
x = [0 2 0];
y = [0 0 2];
fprintf('Area triangle (true value = 2): %g\n', polyarea(x, y));

Filename: polyarea.m.

Exercise 15: Average of integers

Write a program that gets an integer N>1 from the user and computes the average of all integers i=1,,N. The computation should be done in a function that takes N as input parameter. Print the result to the screen with an appropriate text. Run the program with N=5 and confirm that you get the correct answer.

Solution. The code reads:

function average_of_N_integers()
    N = input('Give an integer > 1: ');
    average1toN = average(N);
    fprintf('The average of 1,..., %d is %g\n', N, average1toN);
end

function result = average(N)
    sum = 0;
    for i = 1:N
        sum = sum + i;
    end
    result = sum/N;
end

Running the program gives the following dialog:

Give a positive integer > 1: 5
The average of 1,..., 5 is: 3

Filename: average_1_to_N.m.

Exercise 16: While loop with errors

Assume some program has been written for the task of adding all integers i=1,2,,10:

some_number = 0;
i = 1;
while j < 11;
    some_number += 1
print some_number

a) Identify the errors in the program by just reading the code and simulating the program by hand.

Solution. There is a semicolon at the end of the while loop header which should not be there. There is use of += within the loop, which is wrong in Matlab (the correct way of updating the variable is shown in the corrected program below). Furthermore, 1 is added instead of i. There is no increase of the loop variable i. Finally, the word print will give an error in Matlab. The printing should use fprintf as shown below.

b) Write a new version of the program with errors corrected. Run this program and confirm that it gives the correct output.

Solution. The code reads:

some_number = 0;
i = 1;
while i < 11
    some_number = some_number + i;
    i = i + 1;
end
fprintf('The sum: %d\n', some_number)

Running the program gives 55 as the answer.

Filename: while_loop_errors.m.

Exercise 17: Area of rectangle versus circle

Consider one circle and one rectangle. The circle has a radius r=10.6. The rectangle has sides a and b, but only a is known from the outset. Let a=1.3 and write a program that uses a while loop to find the largest possible integer b that gives a rectangle area smaller than, but as close as possible to, the area of the circle. Run the program and confirm that it gives the right answer (which is b=271).

Solution. The code reads:

r = 10.6;
a = 1.3;
circle_area = pi*r^2;

b = 0;    % chosen starting value for other side of rectangle
while a*b < circle_area
    b = b + 1;
end
b = b - 1;    % must reverse the last update to the right value
fprintf('The largest possible value of b: %d\n', b);

Running the program gives 271 as output for b.

Filename: area_rectangle_vs_circle.m.

Exercise 18: Find crossing points of two graphs

Consider two functions f(x)=x and g(x)=x2 on the interval [4,4].

Write a program that, by trial and error, finds approximately for which values of x the two graphs cross, i.e., f(x)=g(x). Do this by considering N equally distributed points on the interval, at each point checking whether |f(x)g(x)|<ϵ, where ϵ is some small number. Let N and ϵ be user input to the program and let the result be printed to screen. Run your program with N=400 and ϵ=0.01. Explain the output from the program. Finally, try also other values of N, keeping the value of ϵ fixed. Explain your observations.

Solution. The code reads:

f = @(x) x;
g = @(x) x^2;

N = input('Give the number of check-points N: ');
epsilon = input('Give the error tolerance epsilon: ');
x_values = linspace(-4, 4, N);

% Next, we run over all indices in the array `x_values` and check if
% the difference is smaller than the chosen limit. If so, we print x
for i = 1:N
    if abs(f(x_values(i)) - g(x_values(i))) < epsilon
        x_values(i)    % i.e. print that x value to screen
    end
end

Running the program with 400 check-points (i.e. N = 400) and an error tolerance of 0.01 (i.e. epsilon = 0.01) gives the following dialog:

Give the number of check-points N: 400
Give the error tolerance: 0.01

ans = 0.01002506265664

ans = 0.99248120300752

We note that we do not get exactly 0 and 1 (which we know are the answers). This owes to the chosen distribution of x-values. This distribution is decided by N. Trying other combinations of N and epsilon might give more than 2 “solutions”, or fewer, maybe even none. All of this boils down to whether the if test becomes true or not. For example, if you let epsilon stay constant while increasing N, you realize that the difference between f(x) and g(x) will be small for several values of x, allowing more than one x value to “be a solution”. Decreasing N while epsilon is constant will eventually give no solutions, since the difference between f(x) and g(x) at the tested x-values gets too large.

Is is important here to realize the difference between the numerical test we do and the exact solution. The numerical test just gives us an approximation which we may get as “good as we want” by the right choices of N and epsilon.

Filename: crossing_2_graphs.m.

Exercise 19: Sort array with numbers

The built-in function rand may be used to draw pseudo-random numbers for the standard uniform distribution between 0 and 1 (exclusive at both ends). See help rand.

Write a script that generates an array of 6 random numbers between 0 and 10. The program should then sort the array so that numbers appear in increasing order. Let the program make a formatted print of the array to the screen both before and after sorting. The printouts should appear on the screen so that comparison is made easy. Confirm that the array has been sorted correctly.

Solution. The code may be written as follows

N = 6;
numbers = zeros(N, 1);

% Draw random numbers
for i = 1:N
    numbers(i) = 10*rand;
end
fprintf('Unsorted: %5.3f %5.3f %5.3f %5.3f %5.3f %5.3f \n',...
          numbers(1), numbers(2), numbers(3),...
          numbers(4), numbers(5), numbers(6));

for reference = 1:N
    smallest = numbers(reference);
    i_smallest = reference;
    % Find the smallest number in remaining unprinted array
    for i = (reference + 1):N
        if numbers(i) <= smallest
            smallest = numbers(i);
            i_smallest = i;
        end
    end
    % switch numbers, and use an extra variable for that
    switch_number = numbers(reference);
    numbers(reference) = numbers(i_smallest);
    numbers(i_smallest) = switch_number;
end
fprintf('Sorted  : %5.3f %5.3f %5.3f %5.3f %5.3f %5.3f \n',...
          numbers(1), numbers(2), numbers(3),...
          numbers(4), numbers(5), numbers(6))

Filename: sort_numbers.m.

Exercise 20: Compute π

Up through history, great minds have developed different computational schemes for the number π. We will here consider two such schemes, one by Leibniz (16461716), and one by Euler (17071783).

The scheme by Leibniz may be written

π=8k=01(4k+1)(4k+3),

while one form of the Euler scheme may appear as

π=6k=11k2.

If only the first N terms of each sum are used as an approximation to π, each modified scheme will have computed π with some error.

Write a program that takes N as input from the user, and plots the error development with both schemes as the number of iterations approaches N. Your program should also print out the final error achieved with both schemes, i.e. when the number of terms is N. Run the program with N=100 and explain briefly what the graphs show.

Solution. The code may be written as follows

no_of_terms = input('Give number of terms in sum for pi: ');
Leibniz_error = zeros(no_of_terms, 1);
Euler_error = zeros(no_of_terms, 1);

% Leibniz
sum1 = 0;
for k = 0:(no_of_terms-1)
    sum1 = sum1 + 1.0/((4*k + 1)*(4*k + 3));
    Leibniz_error(k+1) = pi - 8*sum1;
end
sum1 = 8*sum1;
final_Leibniz_error = abs(pi - sum1);
fprintf('Leibniz: %g \n', final_Leibniz_error)

% Euler
sum2 = 0;
for k = 1:no_of_terms      % Note index range
    sum2 = sum2 + 1.0/k^2;
    Euler_error(k) = pi - sqrt(6*sum2);
end
sum2 = 6*sum2;
sum2 = sqrt(sum2);
final_Euler_error = abs(pi - sum2);
fprintf('Leibniz: %g \n', final_Euler_error)

figure(); plot([1:no_of_terms], Leibniz_error, 'b-',...
               [1:no_of_terms], Euler_error, 'r-');
xlabel('No of terms');
ylabel('Error with Leibniz (blue) and Euler (red)');

Running the program as told produces the dialog

Give number of terms in sum for pi: 100
Leibniz: 0.00499996875098
Euler: 0.00951612178069

and the plot in Figure Error as a function of number of terms

_images/pi_Leibniz_Euler.png

Error as a function of number of terms

We see that the scheme of Leibniz gives the least error all over the interval. However, the difference in the error with the two schemes becomes smaller as the number of terms increases.

Filename: compute_pi.m.

Exercise 21: Compute combinations of sets

Consider an ID number consisting of two letters and three digits, e.g., RE198. How many different numbers can we have, and how can a program generate all these combinations?

If a collection of n things can have m1 variations of the first thing, m2 of the second and so on, the total number of variations of the collection equals m1m2mn. In particular, the ID number exemplified above can have 2626101010=676,000 variations. To generate all the combinations, we must have five nested for loops. The first two run over all letters A, B, and so on to Z, while the next three run over all digits 0,1,,9.

To convince yourself about this result, start out with an ID number on the form A3 where the first part can vary among A, B, and C, and the digit can be among 1, 2, or 3. We must start with A and combine it with 1, 2, and 3, then continue with B, combined with 1, 2, and 3, and finally combine C with 1, 2, and 3. A double for loop does the work.

a) In a deck of cards, each card is a combination of a rank and a suit. There are 13 ranks: ace (A), 2, 3, 4, 5, 6, 7, 8, 9, 10, jack (J), queen (Q), king (K), and four suits: clubs (C), diamonds (D), hearts (H), and spades (S). A typical card may be D3. Write statements that generate a deck of cards, i.e., all the combinations CA, C2, C3, and so on to SK.

Solution. Program:

pos = 1;
for i = 1:length(suits)
    for j = 1:length(ranks)
        deck_of_cards{pos} = strcat(suits(i), ranks(j));
        pos = pos + 1;
    end
end
deck_of_cards

b) A vehicle registration number is on the form DE562, where the letters vary from A to Z and the digits from 0 to 9. Write statements that compute all the possible registration numbers and stores them in a list.

Solution. Program:

pos = 1;
for L1 = 65:(65+25)    % First letter
    for L2 = 65:(65+25)   % Second letter
       for D1 = 48:57       % First digit
           for D2 = 48:57     % Second digit
               for D3 = 48:57    % Third digit
                    reg_no{pos} = strcat(char(L1), char(L2),...
                                      char(D1), char(D2), char(D3));
                    pos = pos + 1;
               end
           end
       end
    end
end
reg_no

c) Generate all the combinations of throwing two dice (the number of eyes can vary from 1 to 6). Count how many combinations where the sum of the eyes equals 7.

Answer. 6

Solution. Program:

% Note that both dice can be represented by a single set here
dice = ['1', '2', '3', '4', '5', '6'];
pos = 1;
for i = 1:6
    for j = 1:6
        dice_combinations{pos} = dice(i);
        dice_combinations{pos+1} = dice(j);
        pos = pos + 2;
    end
end
%dice_combinations

n = 0;
% convert to numbers
throw = cell2mat(dice_combinations) - 48;  % adjust to right inverval
for i = 1:2:(length(throw))
   %%fprintf('throw(i) = %d, throw(j) = %d\n', throw(i), throw(j));
    if (throw(i) + throw(i+1) == 7)
        n = n + 1;
    end
end
fprintf('No of combinations giving 7: %d\n', n);

Filename: combine_sets.m.

Exercise 22: Frequency of random numbers

Write a program that takes a positive integer N as input and then draws N random integers in the interval [1,6] (both ends inclusive). In the program, count how many of the numbers, M, that equal 6 and write out the fraction M/N. Also, print all the random numbers to the screen so that you can check for yourself that the counting is correct. Run the program with a small value for N (e.g., N = 10) to confirm that it works as intended.

Hint. Use 1+floor(6*rand()) to draw a random integer between 1 and 6.

Solution. The code may be written as follows

N = input('How many random numbers should be drawn? ');

% Draw random numbers
M = 0;    % Counter for the occurences of 6
for i = 1:N
    drawn_number = 1 + floor(6*rand());
    fprintf('Draw number %d gave: %d \n', i, drawn_number);
    if drawn_number == 6
        M = M + 1;
    end
end
fprintf('The fraction M/N became: %g \n', M/float(N));

Running the program produces the dialog

How many random numbers should be drawn? 10
Draw number 1 gave: 2
Draw number 2 gave: 4
Draw number 3 gave: 3
Draw number 4 gave: 2
Draw number 5 gave: 2
Draw number 6 gave: 1
Draw number 7 gave: 2
Draw number 8 gave: 6
Draw number 9 gave: 2
Draw number 10 gave: 3
The fraction M/N became: 0.1

We see that, in this case, 6 was drawn just a single time, so one out of ten gives a fraction M/N of 0.1.

Filename: count_random_numbers.m.

Remarks

For large N, this program computes the probability M/N of getting six eyes when throwing a die.

Exercise 23: Game 21

Consider some game where each participant draws a series of random integers evenly distributed from 0 and 10, with the aim of getting the sum as close as possible to 21, but not larger than 21. You are out of the game if the sum passes 21. After each draw, you are told the number and your total sum, and is asked whether you want another draw or not. The one coming closest to 21 is the winner.

Implement this game in a program.

Hint. Use floor(11*rand()) to draw random integers in [0,10].

Solution. The code may be written as follows

upper_limit = 21;
answer = input('Are you ready to make the first draw (y/n)? ', 's');
not_finished = true;
sum = 0
while not_finished
    next_number = floor(11*rand());
    fprintf('You got: %d \n', next_number);
    sum = sum + next_number;
    if sum > upper_limit
       fprintf(...
       'Game over, you passed 21 (with your %d points)! \n', sum);
       not_finished = false;
    else
       fprintf('Your score is now: %d points! \n', sum);
       answer = input('Another draw (y/n)? ', 's');
       if answer ~= 'y'
           not_finished = false;
       end
    end
end
fprintf('Finished! \n');

Running the program may produce this dialog

You got: 8
Your score is now: 8 points!

Another draw (y/n)? y
You got: 6
Your score is now: 14 points!

Another draw (y/n)? y
You got: 8
Game over, you passed 21 (with your 22 points)!

Filename: game_21.m.

Exercise 24: Linear interpolation

Some measurements yi, i=1,2,,N (given below), of a quantity y have been collected regularly, once every minute, at times ti=i, i=0,1,,N. We want to find the value y in between the measurements, e.g., at t=3.2 min. Computing such y values is called interpolation.

Let your program use linear interpolation to compute y between two consecutive measurements:

  1. Find i such that titti+1.
  2. Find a mathematical expression for the straight line that goes through the points (i,yi) and (i+1,yi+1).
  3. Compute the y value by inserting the user’s time value in the expression for the straight line.

a) Implement the linear interpolation technique in a function that takes an array with the yi measurements as input, together with some time t, and returns the interpolated y value at time t.

Solution. See the function interpolate in the script below

b) Write another function with in a loop where the user is asked for a time on the interval [0,N] and the corresponding (interpolated) y value is written to the screen. The loop is terminated when the user gives a negative time.

Solution. See the function find_y in the script below

c) Use the following measurements: 4.4,2.0,11.0,21.5,7.5, corresponding to times 0,1,,4 (min), and compute interpolated values at t=2.5 and t=3.1 min. Perform separate hand calculations to check that the output from the program is correct.

Solution. The code may be written as follows

function linear_interpolation()
    % From measurement data y (collected once every minute),
    % linear interpolation is used to find values in between
    % measured data.

    % Note: do not need to store the sequence of times
    N = 4;           % Total number of measurements
    delta_t = 1;     % Time difference between measurements

    % Note: y(1) is measurement at time zero
    y = zeros(5,1);
    y(1) = 4.4; y(2) = 2.0; y(3) = 11.0;
    y(4) = 21.5; y(5) = 7.5;

    find_y(y,N,delta_t);
end

function result = interpolate(y, t, delta_t)
    % Uses linear interpolation to find intermediate y
    i = floor(t) + 1;
    % Scheme: y(t) = y_i + delta-y/delta-t * dt
    result = y(i) + ((y(i+1) - y(i))/delta_t)*(t-floor(t));
end

function find_y(y, N, delta_t)
    fprintf('For time t on the interval [0,%d]... \n', N);
    t = input('Give your desired t: ');
    while t >= 0
        fprintf('y(t) = %g \n', interpolate(y, t, delta_t));
        t = input('Give new time t: ');
    end
end

Running the program may produce this dialog

For time t on the interval [0,4]...
Give your desired t: 2.5
y(t) = 16.25

Give new time t: 0.5
y(t) = 3.2

Give new time t: -1

Filename: linear_interpolation.m.

Exercise 25: Test straight line requirement

Assume the straight line function f(x)=4x+1. Write a script that tests the “point-slope” form for this line as follows. Within a chosen interval on the x-axis (for example, for x between 0 and 10), randomly pick 100 points on the line and check if the following requirement is fulfilled for each point:

f(xi)f(c)xic=a,i=1,2,,100,

where a is the slope of the line and c defines a fixed point (c,f(c)) on the line. Let c=2 here.

Solution. The code may be written as follows

% For a straight line f(x) = ax + b, and the fixed point (2,f(2)) on
% the line, the script tests whether (f(x_i) - f(2)) / (x_i - 2) = a
% for randomly chosen x_i, i = 1,...,100.

a = 4; b = 1;
f = @(x) a*x + b;
c = 2; f_c = f(c);       % Fixed point on the line
epsilon = 1e-6;
i = 0;
for i = 1:100
    x = 10*rand();   % rand() returns number between 0 and 1 ...
    numerator = f(x) - f_c;
    denominator = x - c;
    if denominator > epsilon     % to avoid zero division
        fraction = numerator/denominator;
        % The following printout should be very close to zero in
        % each case IF the points are on the line
        fprintf('For x = %g : %g \n', x, abs(fraction - a));
    end
end

The potential problem of zero division is here simply handled by the if test, meaning that if the denominator is too close to zero, that particular x is skipped. A more elegant procedure would be to use a try-catch construction.

Running the program generates a printout of 100 lines that for each x drawn gives 0 as result from the test. The two last lines of the printout read:

For x = 2.67588 : 0
For x = 9.75893 : 0

Note that since the x values are (pseudo-)random in nature, a second run gives different values for x (but still 0 for each test!).

Filename: test_straight_line.m.

Exercise 26: Fit straight line to data

Assume some measurements yi,i=1,2,,5 have been collected, once every second. Your task is to write a program that fits a straight line to those data.

a) Make a function that computes the error between the straight line f(x)=ax+b and the measurements:

e=5i=1(axi+byi)2.

Solution. See the function find_error in the script below.

b) Make a function with a loop where you give a and b, the corresponding value of e is written to the screen, and a plot of the straight line f(x)=ax+b together with the discrete measurements is shown.

Solution. See the function interactive_line_fit in the script below.

c) Given the measurements 0.5,2.0,1.0,1.5,7.5, at times 0,1,2,3,4, use the function in b) to interactively search for a and b such that e is minimized.

Solution. The code may be written as follows

function interactive_line_fit()
    data = [0.5 2.0 1.0 1.5 7.5];
    time = [0 1 2 3 4];

    one_more = true;
    while one_more
        a = input('Give a: ')
        b = input('Give b: ')
        error = find_error(time, data, a, b);
        fprintf('The error is: %g \n', error);
        y = f(time, a, b);
        figure(); plot(time, y, time, data, '*');
        xlabel('Time (s)');
        ylabel('y (stars) and straight line f(t)');
        answer = input('Do you want another fit (y/n)? ','s');
        if answer == 'n'
            one_more = false;
        end
    end
end

function result = f(t, a, b)
    result = a*t + b;
end

function result = find_error(time, data, a, b)
    E = 0
    for i = 1:length(time)
        E = E + (f(time(i),a,b) - data(i))^2;
    end
    result = E;
end

Running the program may produce this dialog

Give a: 1
Give b: 0
The error is: 16.75

(followed by the plot seen in Figure Straight line fitted to data with first choice of line parameters (a and b))

_images/fit_straight_line_1.png

Straight line fitted to data with first choice of line parameters (a and b)

Do you want another fit (y/n)? y
Give a: 0.5
Give b: 1
The error is: 22.75

(followed by the plot seen in Figure Straight line fitted to data with second choice of line parameters (a and b))

_images/fit_straight_line_2.png

Straight line fitted to data with second choice of line parameters (a and b)

Do you want another fit (y/n)? n

Filename: fit_straight_line.m.

Remarks

Fitting a straight line to measured data points is a very common task. The manual search procedure in c) can be automated by using a mathematical method called the method of least squares.

Exercise 27: Fit sines to straight line

A lot of technology, especially most types of digital audio devices for processing sound, is based on representing a signal of time as a sum of sine functions. Say the signal is some function f(t) on the interval [π,π] (a more general interval [a,b] can easily be treated, but leads to slightly more complicated formulas). Instead of working with f(t) directly, we approximate f by the sum

SN(t)=Nn=1bnsin(nt),

where the coefficients bn must be adjusted such that SN(t) is a good approximation to f(t). We shall in this exercise adjust bn by a trial-and-error process.

a) Make a function sinesum(t, b) that returns SN(t), given the coefficients bn in an array b and time coordinates in an array t. Note that if t is an array, the return value is also an array.

Solution. See the script below.

b) Write a function test_sinesum() that calls sinesum(t, b) in a) and determines if the function computes a test case correctly. As test case, let t be an array with values π/2 and π/4, choose N=2, and b1=4 and b2=3. Compute SN(t) by hand to get reference values.

Solution. See the script below. Note that the call to test_sinesum is commented out, but the function will step into action if the leading # is removed.

c) Make a function plot_compare(f, N, M) that plots the original function f(t) together with the sum of sines SN(t), so that the quality of the approximation SN(t) can be examined visually. The argument f is a Matlab function implementing f(t), N is the number of terms in the sum SN(t), and M is the number of uniformly distributed t coordinates used to plot f and SN.

Solution. See the script below.

d) Write a function error(b, f, M) that returns a mathematical measure of the error in SN(t) as an approximation to f(t):

E=i(f(ti)SN(ti))2,

where the ti values are M uniformly distributed coordinates on [π,π]. The array b holds the coefficients in SN and f is a Matlab function implementing the mathematical function f(t).

Solution. See the script below.

e) Make a function trial(f, N) for interactively giving bn values and getting a plot on the screen where the resulting SN(t) is plotted together with f(t). The error in the approximation should also be computed as indicated in d). The argument f is a Matlab function for f(t) and N is the number of terms N in the sum SN(t). The trial function can run a loop where the user is asked for the bn values in each pass of the loop and the corresponding plot is shown. You must find a way to terminate the loop when the experiments are over. Use M=500 in the calls to plot_compare and error.

Solution. See the script below. Note that the call to trial is commented out, but the function will run if the leading # is removed.

f) Choose f(t) to be a straight line f(t)=1πt on [π,π]. Call trial(f, 3) and try to find through experimentation some values b1, b2, and b3 such that the sum of sines SN(t) is a good approximation to the straight line.

Solution. See the function trial in the script below.

g) Now we shall try to automate the procedure in f). Write a function that has three nested loops over values of b1, b2, and b3. Let each loop cover the interval [1,1] in steps of 0.1. For each combination of b1, b2, and b3, the error in the approximation SN should be computed. Use this to find, and print, the smallest error and the corresponding values of b1, b2, and b3. Let the program also plot f and the approximation SN corresponding to the smallest error.

Solution. The code may be written as follows

function fit_sines()
    % Search for b-values, - just pick limits and step

    left_end = -pi; right_end = pi;
    N = 3;
    b = zeros(N,1);
    f = @(t) (1/pi)*t;

    M = 500;

    %test_sinesum();
    %trial(left_end, right_end, f, b, N, M);

    % Produce and store an initially "smallest" error
    b(1) = -1; b(2) = -1; b(3) = -1;
    test_b = b;
    smallest_E = error(left_end, right_end, test_b, f, M);
    db = 0.1;
    for b1 = -1:db:1
        for b2 = -1:db:1
            for b3 = -1:db:1
                test_b(1) = b1; test_b(2) = b2;
                test_b(3) = b3;
                E = error(left_end, right_end, test_b, f, M);
                if E < smallest_E
                    b = test_b;
                    smallest_E = E;
                end
            end
        end
    end
    b
    plot_compare(left_end, right_end, f, b, N, M)
    fprintf('b coeffiecients: %g %g and %g \n', b(1), b(2), b(3));
    fprintf('Smallest error found: %g \n', smallest_E);
end

function result = sinesum(t, b)
    % Computes S as the sum over n of b_n * sin(n*t)
    % For each point in time (M) we loop over all b_n to
    % produce one element S(M), i.e. one element in
    % S corresponds to one point in time.
    S = zeros(length(t),1);
    for M = 1:length(t)
        for n = 1:length(b)
            S(M) = S(M) + b(n)*sin(n*t(M));
        end
    end
    result = S;
end

function test_sinesum()
    t = zeros(2,1); t(1) = -pi/2; t(2) = pi/4;
    b = zeros(2,1); b(1) = 4.0; b(2) = -3;
    sinesum(t,b)
end

function plot_compare(left_end, right_end, f, b, N, M)
    time = linspace(left_end, right_end, M);
    y = f(time);
    S = sinesum(time, b);
    plot(time, y, 'b-', time, S, 'r--');
    xlabel('Time');
    ylabel('f (blue) and S (red)');
end

function result = error(left_end, right_end, b, f, M)
    time = linspace(left_end, right_end, M);
    y = f(time);
    S = sinesum(time, b);
    E = 0;
    for i = 1:length(time)
        E = E + sqrt((y(i) - S(i))^2);
    end
    result = E;
end

function trial(left_end, right_end, f, b, N, M)
    M = 500;
    new_trial = true;
    while new_trial
        for i = 1:N
            text = strcat('Give b', num2str(i), ' : \n');
            b(i) = input(text);
        end
        plot_compare(left_end, right_end, f, b, N, M)
        fprintf('Error: \n',error(left_end, right_end, b, f, M));
        answer = input('Another trial (y/n)? ','s');
        if answer == 'n'
            new_trial = false;
        end
    end
end

Running the program may produce this dialog

The b coefficients: [ 0.6 -0.2 0.1 ]
The smallest error found: 67.1213886326

and the plot seen in Figure Straight line fitted to data with first choice of line parameters (a and b)

_images/fit_sines.png

Straight line fitted to data with first choice of line parameters (a and b)

Filename: fit_sines.m.

Remarks

  1. The function SN(x) is a special case of what is called a Fourier series. At the beginning of the 19th century, Joseph Fourier (1768-1830) showed that any function can be approximated analytically by a sum of cosines and sines. The approximation improves as the number of terms (N) is increased. Fourier series are very important throughout science and engineering today.
  1. Finding the coefficients bn is solved much more accurately in Exercise 40: Revisit fit of sines to a function, by a procedure that also requires much less human and computer work!
  2. In real applications, f(t) is not known as a continuous function, but function values of f(t) are provided. For example, in digital sound applications, music in a CD-quality WAV file is a signal with 44100 samples of the corresponding analog signal f(t) per second.

Exercise 28: Count occurrences of a string in a string

In the analysis of genes one encounters many problem settings involving searching for certain combinations of letters in a long string. For example, we may have a string like

gene = 'AGTCAATGGAATAGGCCAAGCGAATATTTGGGCTACCA'

We may traverse this string letter by letter. The length of the string is given by length(gene), so with a loop index i, for i = 1:length(gene) will produce the required index values. Letter number i is then reached through gene(i), and a substring from index i up to and including j, is created by gene(i:j).

a) Write a function freq(letter, text) that returns the frequency of the letter letter in the string text, i.e., the number of occurrences of letter divided by the length of text. Call the function to determine the frequency of C and G in the gene string above. Compute the frequency by hand too.

b) Write a function pairs(letter, text) that counts how many times a pair of the letter letter (e.g., GG) occurs within the string text. Use the function to determine how many times the pair AA appears in the string gene above. Perform a manual counting too to check the answer.

c) Write a function mystruct(text) that counts the number of a certain structure in the string text. The structure is defined as G followed by A or T until a double GG. Perform a manual search for the structure too to control the computations by mystruct.

Solution. Here is a program:

function count_substrings()
    gene = 'AGTCAATGGAATAGGCCAAGCGAATATTTGGGCTACCA';

    fprintf('frequency of C: %.1f\n', freq('C', gene));
    fprintf('frequency of G: %.1f\n', freq('G', gene));
    fprintf('no of pairs AA: %d\n', pairs('A', gene));
    fprintf('no of structures: %d\n', mystruct(gene));
end

function result = freq(letter, text)
    counter = 0;
    for i = 1:length(text)
        if text(i) == letter
            counter = counter + 1;
        end
    end
    result = counter/length(text);
end

function result = pairs(letter, text)
    counter = 0;
    for i = 1:length(text)
        if i <= length(text)-1 && text(i) == letter...
                               && text(i+1) == letter
            counter = counter + 1;
        end
    end
    result = counter;
end

function result = mystruct(text)
    counter = 0;
    for i = 1:length(text)
        %% Search for the structure from position i
        if text(i) == 'G'
            fprintf('found G at %d\n', i);
            %% Search among A and T letters
            j = i + 1;
            while text(j) == 'A' || text(j) == 'T'
                fprintf('next is ok: %s\n', text(j));
                j = j + 1;
            end
            fprintf('ending is %s\n', text(j:j+1));
            if text(j:j+1) == 'GG'
                %% Correct ending of structure
                counter = counter + 1;
                fprintf('yes\n');
            end
        end
    end
    result = counter;
end

Filename: count_substrings.m.